Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTCACTGCAGGACACAGGGATCTC[C/T]GAACTCCTGGGCTGAGGATGATTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602434 MIM: 610231 MIM: 604240 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AUP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AUP1 - ancient ubiquitous protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DQX1 - DEAQ-box RNA dependent ATPase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_133637.2 | 1584 | Missense Mutation | AGA,GGA | R,G 711 | NP_598376.2 | |
XM_011532644.1 | 1584 | Missense Mutation | AGA,GGA | R,G 593 | XP_011530946.1 | |
XM_011532645.1 | 1584 | Missense Mutation | AGA,GGA | R,G 469 | XP_011530947.1 | |
XM_011532646.2 | 1584 | Intron | XP_011530948.1 | |||
XM_017003520.1 | 1584 | Missense Mutation | AGA,GGA | R,G 379 | XP_016859009.1 |
PCGF1 - polycomb group ring finger 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TLX2 - T-cell leukemia homeobox 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |