Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGTCCTCTGCCTCAGGGCTTCTC[C/G]CACACTCATGTCCAGGTGGTTGTAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606530 MIM: 604976 | ||||||||||||||||||||
Literature Links: |
CYP27A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CYP27A1 - cytochrome P450 family 27 subfamily A member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR9500 - microRNA 9500 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRKAG3 - protein kinase AMP-activated non-catalytic subunit gamma 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017431.2 | 1271 | Missense Mutation | CGA,GGA | R,G 418 | NP_059127.2 | |
XM_017004343.1 | 1271 | Missense Mutation | CGA,GGA | R,G 418 | XP_016859832.1 |