Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCAAGATGCCTCGGGCGTCTCCCC[A/G]CTGCACCTGGCCGCCCGTTTTGGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611056 | ||||||||||||||||||||
Literature Links: |
ESPNL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ESPNL - espin-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308370.1 | 431 | Intron | NP_001295299.1 | |||
NM_194312.3 | 431 | Silent Mutation | CCA,CCG | P,P 107 | NP_919288.2 | |
XM_011511087.1 | 431 | Intron | XP_011509389.1 |
SCLY - selenocysteine lyase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBE2F-SCLY - UBE2F-SCLY readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |