Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TACTAAGCCCCTAAAATGTCGAGAT[C/T]TGTACAAGGTAAGAAATGCTGCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 191760 MIM: 613580 | ||||||||||||||||||||
Literature Links: |
LOC647115 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC647115 - translation initiation factor IF-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGP2 - UDP-glucose pyrophosphorylase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001521.1 | 308 | Intron | NP_001001521.1 | |||
NM_006759.3 | 308 | Missense Mutation | TCT,TTT | S,F 4 | NP_006750.3 | |
XM_005264537.2 | 308 | UTR 5 | XP_005264594.1 | |||
XM_005264538.1 | 308 | Intron | XP_005264595.1 | |||
XM_006712088.1 | 308 | Intron | XP_006712151.1 | |||
XM_011533091.1 | 308 | Intron | XP_011531393.1 | |||
XM_017004855.1 | 308 | Intron | XP_016860344.1 | |||
XM_017004856.1 | 308 | Intron | XP_016860345.1 | |||
XM_017004857.1 | 308 | Intron | XP_016860346.1 |
WDPCP - WD repeat containing planar cell polarity effector | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |