Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCCCTCGTATCAGGGCCACCAC[C/T]GCTGTTGTACCACTGTCAGAGCCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605119 MIM: 605963 MIM: 613598 | ||||||||||||||||||||
Literature Links: |
FTH1P3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FTH1P3 - ferritin heavy chain 1 pseudogene 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPM1G - protein phosphatase, Mg2+/Mn2+ dependent 1G | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_177983.2 | 1254 | Silent Mutation | GCA,GCG | A,A 331 | NP_817092.1 |
SNX17 - sorting nexin 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF513 - zinc finger protein 513 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |