Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGATAGCCAACTGCTTGCACCTGA[A/G]TGACACGCAAGTCAAAATCTGGTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142987 | ||||||||||||||||||||
Literature Links: |
HAGLR PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HAGLR - HOXD antisense growth-associated long non-coding RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXD1 - homeobox D1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024501.2 | 1070 | Missense Mutation | AAT,AGT | N,S 269 | NP_078777.1 | |
XM_005246507.3 | 1070 | UTR 3 | XP_005246564.1 |
MIR7704 - microRNA 7704 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |