Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGCTTCTTGGACAAAATGCTCTG[C/T]GGAAATTCCCTCCTGGGTAGCGTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
CATIP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CATIP - ciliogenesis associated TTC17 interacting protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320865.1 | 500 | Silent Mutation | TGC,TGT | C,C 112 | NP_001307794.1 | |
NM_198559.1 | 500 | Silent Mutation | TGC,TGT | C,C 101 | NP_940961.1 | |
XM_005246539.4 | 500 | Silent Mutation | TGC,TGT | C,C 70 | XP_005246596.1 | |
XM_005246541.4 | 500 | Intron | XP_005246598.1 | |||
XM_011511148.2 | 500 | Silent Mutation | TGC,TGT | C,C 112 | XP_011509450.1 | |
XM_011511149.2 | 500 | UTR 5 | XP_011509451.1 | |||
XM_011511150.2 | 500 | Intron | XP_011509452.1 | |||
XM_017004053.1 | 500 | UTR 5 | XP_016859542.1 |
CATIP-AS1 - CATIP antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CATIP-AS2 - CATIP antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |