Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAAAATGCGGGCGGGAAAGCTGG[C/T]AGAATGATTACTTTCAGGTCCCCTC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 605597 | |||||||||||||||||||||||
Literature Links: |
FOXL2 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
FOXL2 - forkhead box L2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FOXL2NB - FOXL2 neighbor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040061.2 | Intron | NP_001035150.1 | ||||
XM_005247443.3 | Intron | XP_005247500.1 |
LINC01391 - long intergenic non-protein coding RNA 1391 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |