Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGACCACAAGCTCCTTATCGCCCTC[C/G]TCCTCCGCAGTCCACCACACAGCCG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 600470 MIM: 608948 | |||||||||||||||||||||||
Literature Links: |
LOC440982 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LOC440982 - uncharacterized LOC440982 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZIC1 - Zic family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003412.3 | 1994 | Silent Mutation | TCC,TCG | S,S 425 | NP_003403.2 |
ZIC4 - Zic family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |