Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAATTGGATACTTCCACTGCTTTGT[C/T]AGGTATTCATCTGAAGAATACAACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606045 MIM: 603574 | ||||||||||||||||||||
Literature Links: |
EFCAB12 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EFCAB12 - EF-hand calcium binding domain 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IFT122 - intraflagellar transport 122 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MBD4 - methyl-CpG binding domain 4, DNA glycosylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001276270.1 | 1918 | Silent Mutation | CTA,CTG | L,L 518 | NP_001263199.1 | |
NM_001276271.1 | 1918 | Silent Mutation | CTA,CTG | L,L 524 | NP_001263200.1 | |
NM_001276272.1 | 1918 | Silent Mutation | CTA,CTG | L,L 524 | NP_001263201.1 | |
NM_001276273.1 | 1918 | Silent Mutation | CTA,CTG | L,L 206 | NP_001263202.1 | |
NM_003925.2 | 1918 | Silent Mutation | CTA,CTG | L,L 524 | NP_003916.1 | |
XM_011513268.2 | 1918 | Silent Mutation | CTA,CTG | L,L 129 | XP_011511570.1 |