Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCATATGCAAATGCTGTCTGCAGA[G/T]CCCATTTTAAAGCCCTGAAGGTGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608501 | ||||||||||||||||||||
Literature Links: |
LINC00994 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LINC00994 - long intergenic non-protein coding RNA 994 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRICKLE2 - prickle planar cell polarity protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198859.3 | 7007 | UTR 3 | NP_942559.1 | |||
XM_011533432.2 | 7007 | UTR 3 | XP_011531734.1 | |||
XM_011533433.2 | 7007 | UTR 3 | XP_011531735.1 | |||
XM_011533434.2 | 7007 | UTR 3 | XP_011531736.1 | |||
XM_011533435.2 | 7007 | UTR 3 | XP_011531737.1 | |||
XM_011533436.2 | 7007 | UTR 3 | XP_011531738.1 | |||
XM_011533437.2 | 7007 | UTR 3 | XP_011531739.1 | |||
XM_011533438.2 | 7007 | UTR 3 | XP_011531740.1 | |||
XM_011533440.2 | 7007 | UTR 3 | XP_011531742.1 | |||
XM_017005798.1 | 7007 | UTR 3 | XP_016861287.1 | |||
XM_017005799.1 | 7007 | UTR 3 | XP_016861288.1 |
PRICKLE2-AS1 - PRICKLE2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRICKLE2-AS2 - PRICKLE2 antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |