Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCCTTTAACTCTCACACGTGGGA[G/T]CAGCTGGGCACACTGCAGCTACTGT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 104620 | |||||||||||||||||||||||
Literature Links: |
ABHD14A PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ABHD14A - abhydrolase domain containing 14A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015407.4 | 443 | Missense Mutation | GAG,GAT | E,D 111 | NP_056222.2 |
ABHD14A-ACY1 - ABHD14A-ACY1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316331.1 | 443 | Missense Mutation | AGC,ATC | S,I 63 | NP_001303260.1 |
ABHD14B - abhydrolase domain containing 14B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ACY1 - aminoacylase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |