Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
TTGAAGGGGAAGCTGCACTTCTCCA[C/T]GGCACGCCTGGTGGTGCCAGGGGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605133 MIM: 611671 | ||||||||||||||||||||
Literature Links: |
NCBP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NCBP2 - nuclear cap binding protein subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NCBP2-AS2 - NCBP2 antisense RNA 2 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGZ - phosphatidylinositol glycan anchor biosynthesis class Z | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_025163.3 | 1776 | Missense Mutation | NP_079439.2 | |||
XM_011513190.1 | 1776 | Missense Mutation | XP_011511492.1 | |||
XM_011513192.2 | 1776 | Missense Mutation | XP_011511494.1 | |||
XM_017007240.1 | 1776 | Missense Mutation | XP_016862729.1 | |||
XM_017007241.1 | 1776 | Missense Mutation | XP_016862730.1 | |||
XM_017007242.1 | 1776 | Missense Mutation | XP_016862731.1 | |||
XM_017007243.1 | 1776 | Missense Mutation | XP_016862732.1 |