Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAACGTACACAGATGAGCGTGGCT[A/G]TGTTCCAATAACCTTTTACTTAGGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 109565 MIM: 609138 | |||||||||||||||||||||||
Literature Links: |
BCL6 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
BCL6 - B-cell CLL/lymphoma 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130845.1 | Intron | NP_001124317.1 | ||||
NM_001134738.1 | Intron | NP_001128210.1 | ||||
NM_001706.4 | Intron | NP_001697.2 | ||||
XM_005247694.3 | Intron | XP_005247751.1 | ||||
XM_011513062.2 | Intron | XP_011511364.1 |
LOC100131635 - hCG1645011-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RTP2 - receptor transporter protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |