Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATCTCAGGGAAGAAAGTGGCGAAA[C/G]CAAAGTGGTCAGCCATGTCCCCTCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607082 MIM: 607068 MIM: 607072 MIM: 607069 | ||||||||||||||||||||
Literature Links: |
CACNA2D2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CACNA2D2 - calcium voltage-gated channel auxiliary subunit alpha2delta 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CYB561D2 - cytochrome b561 family member D2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291284.1 | 1113 | Intron | NP_001278213.1 | |||
NM_007022.4 | 1113 | Intron | NP_008953.1 |
NPRL2 - NPR2-like, GATOR1 complex subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM115 - transmembrane protein 115 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007024.4 | 1113 | Missense Mutation | GCT,GGT | A,G 223 | NP_008955.1 |