Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCACAATCTCTTTAGTCTGAAGGTT[C/T]CAAATGTAAACCAGGTTATCCTCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608017 MIM: 600686 | ||||||||||||||||||||
Literature Links: |
FAM162A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM162A - family with sequence similarity 162 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KPNA1 - karyopherin subunit alpha 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102723582 - uncharacterized LOC102723582 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR5B - WD repeat domain 5B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_019069.3 | 1353 | Nonsense Mutation | TGA,TGG | *,W 282 | NP_061942.2 |