Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GCAAGAGGCCGATGGGGACATCCAG[C/T]GATAGGACAATGCGCGAGCCAGGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 120120 MIM: 605320 MIM: 605902 | ||||||||||||||||||||
Literature Links: |
COL7A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COL7A1 - collagen type VII alpha 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PFKFB4 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317134.1 | 303 | Intron | NP_001304063.1 | |||
NM_001317135.1 | 303 | Intron | NP_001304064.1 | |||
NM_001317136.1 | 303 | Intron | NP_001304065.1 | |||
NM_001317137.1 | 303 | Intron | NP_001304066.1 | |||
NM_001317138.1 | 303 | Intron | NP_001304067.1 | |||
NM_004567.3 | 303 | Intron | NP_004558.1 | |||
XM_011533829.2 | 303 | Intron | XP_011532131.1 | |||
XM_017006614.1 | 303 | Intron | XP_016862103.1 | |||
XM_017006615.1 | 303 | Intron | XP_016862104.1 | |||
XM_017006616.1 | 303 | Intron | XP_016862105.1 | |||
XM_017006617.1 | 303 | Intron | XP_016862106.1 |
UCN2 - urocortin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033199.3 | 303 | Silent Mutation | TCA,TCG | S,S 75 | NP_149976.1 |