Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAAGTGAAGGTGTCTTATAAAATTC[A/C]TCATCTCGACGTTGGTAAAATAGCA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 603486 | |||||||||||||||||||||||
Literature Links: |
C3orf62 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
C3orf62 - chromosome 3 open reading frame 62 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4271 - microRNA 4271 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP4 - ubiquitin specific peptidase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001251877.1 | 2713 | Intron | NP_001238806.1 | |||
NM_003363.3 | 2713 | Missense Mutation | GAG,GAT | E,D 925 | NP_003354.2 | |
NM_199443.2 | 2713 | Missense Mutation | GAG,GAT | E,D 878 | NP_955475.1 |