Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCTCTGTGCTGCCTGTCACAGCC[C/T]GATGGTACCAGCGCAGGGTGTAGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 120120 MIM: 605320 MIM: 605902 | ||||||||||||||||||||
Literature Links: |
COL7A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COL7A1 - collagen type VII alpha 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000094.3 | 8720 | Missense Mutation | CAG,CGG | Q,R 2895 | NP_000085.1 | |
XM_011533337.1 | 8720 | Missense Mutation | CAG,CGG | Q,R 2895 | XP_011531639.1 | |
XM_017005688.1 | 8720 | Missense Mutation | CAG,CGG | Q,R 2875 | XP_016861177.1 | |
XM_017005689.1 | 8720 | Intron | XP_016861178.1 | |||
XM_017005690.1 | 8720 | Intron | XP_016861179.1 | |||
XM_017005691.1 | 8720 | Intron | XP_016861180.1 | |||
XM_017005692.1 | 8720 | Intron | XP_016861181.1 |
PFKFB4 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UCN2 - urocortin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |