Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCATTGCCCTGAACCCTCAGCGTG[C/T]GTCTGCCGTCATCTGATGCTGCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 146650 MIM: 600564 | ||||||||||||||||||||
Literature Links: |
ITIH3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ITIH3 - inter-alpha-trypsin inhibitor heavy chain 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ITIH4 - inter-alpha-trypsin inhibitor heavy chain family member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166449.1 | 2653 | Missense Mutation | CAC,CGC | H,R 865 | NP_001159921.1 | |
NM_002218.4 | 2653 | Missense Mutation | CAC,CGC | H,R 895 | NP_002209.2 |
ITIH4-AS1 - ITIH4 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |