Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTTATTTGAAGTCACAGAAAGGAG[A/G]AACTTTTCTCAAGCCGTTTTTATTA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 606400 MIM: 605612 | |||||||||||||||||||||||
Literature Links: |
CAPN7 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CAPN7 - calpain 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SH3BP5 - SH3 domain binding protein 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018009.3 | 2707 | UTR 3 | NP_001018009.2 | |||
NM_004844.4 | 2707 | UTR 3 | NP_004835.2 | |||
XM_011534251.2 | 2707 | Intron | XP_011532553.1 | |||
XM_011534253.1 | 2707 | Intron | XP_011532555.1 | |||
XM_017007521.1 | 2707 | Intron | XP_016863010.1 | |||
XM_017007522.1 | 2707 | Intron | XP_016863011.1 | |||
XM_017007523.1 | 2707 | Intron | XP_016863012.1 | |||
XM_017007524.1 | 2707 | Intron | XP_016863013.1 | |||
XM_017007525.1 | 2707 | Intron | XP_016863014.1 |
SH3BP5-AS1 - SH3BP5 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |