Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCTCGGAGGTGTCAGGCAGCAC[A/G]TGGCGAGAGGAAGAACTGCCTGTAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 191325 | ||||||||||||||||||||
Literature Links: |
CDHR4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDHR4 - cadherin related family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM212A - family with sequence similarity 212 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_203370.1 | 448 | Silent Mutation | ACA,ACG | T,T 105 | NP_976248.1 | |
XM_017006372.1 | 448 | Silent Mutation | ACA,ACG | T,T 164 | XP_016861861.1 |
MIR5193 - microRNA 5193 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBA7 - ubiquitin like modifier activating enzyme 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003335.2 | 448 | Intron | NP_003326.2 | |||
XM_005265430.2 | 448 | Intron | XP_005265487.1 | |||
XM_006713321.2 | 448 | Intron | XP_006713384.1 | |||
XM_011534070.1 | 448 | Intron | XP_011532372.1 | |||
XM_011534071.1 | 448 | Intron | XP_011532373.1 | |||
XM_011534072.1 | 448 | Intron | XP_011532374.1 |