Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACAAGTAGGAGAAGCAAGACTGAA[C/T]CTTAAATCTCCTAATTCCCAGGGAG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||
Literature Links: |
GTPBP8 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
GTPBP8 - GTP binding protein 8 (putative) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEPRO - nucleolus and neural progenitor protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001319109.1 | 3455 | UTR 3 | NP_001306038.1 | |||
NM_001319110.1 | 3455 | UTR 3 | NP_001306039.1 | |||
NM_001319111.1 | 3455 | UTR 3 | NP_001306040.1 | |||
NM_001319112.1 | 3455 | UTR 3 | NP_001306041.1 | |||
NM_001319114.1 | 3455 | UTR 3 | NP_001306043.1 | |||
NM_001319115.1 | 3455 | UTR 3 | NP_001306044.1 | |||
NM_015412.3 | 3455 | UTR 3 | NP_056227.2 | |||
XM_005247276.2 | 3455 | Intron | XP_005247333.1 | |||
XM_011512635.2 | 3455 | Intron | XP_011510937.1 | |||
XM_011512636.2 | 3455 | Intron | XP_011510938.1 | |||
XM_011512638.2 | 3455 | Intron | XP_011510940.1 | |||
XM_017006102.1 | 3455 | UTR 3 | XP_016861591.1 | |||
XM_017006103.1 | 3455 | Intron | XP_016861592.1 |