Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTCTGCGGGGCCACCATGGCAAC[C/T]GGGGGTGTCTGAGTGGTAGGGGCGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606026 MIM: 602952 | ||||||||||||||||||||
Literature Links: |
MIR943 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR943 - microRNA 943 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NELFA - negative elongation factor complex member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005663.4 | 1509 | Silent Mutation | CCA,CCG | P,P 422 | NP_005654.3 | |
XM_017008589.1 | 1509 | Silent Mutation | CCA,CCG | P,P 450 | XP_016864078.1 |
SCARNA22 - small Cajal body-specific RNA 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WHSC1 - Wolf-Hirschhorn syndrome candidate 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |