Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCTGCAAACGGGCGCTGACCTCA[A/G]CCAGCAGGTAACTAGGTAACTGTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611482 | ||||||||||||||||||||
Literature Links: |
ANKRD37 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKRD37 - ankyrin repeat domain 37 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_181726.3 | 256 | Missense Mutation | AAC,AGC | N,S 58 | NP_859077.1 | |
XM_017008176.1 | 256 | Missense Mutation | AAC,AGC | N,S 58 | XP_016863665.1 |
C4orf47 - chromosome 4 open reading frame 47 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRP2BP - LRP2 binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018409.3 | 256 | Intron | NP_060879.2 | |||
XM_005263125.4 | 256 | Intron | XP_005263182.1 | |||
XM_006714260.3 | 256 | Intron | XP_006714323.1 | |||
XM_006714265.3 | 256 | Intron | XP_006714328.1 | |||
XM_011532110.2 | 256 | Intron | XP_011530412.1 | |||
XM_011532111.2 | 256 | Intron | XP_011530413.1 | |||
XM_017008410.1 | 256 | Intron | XP_016863899.1 | |||
XM_017008411.1 | 256 | Intron | XP_016863900.1 |
UFSP2 - UFM1 specific peptidase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |