Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGTTAAAAAGCTGCTTTACTTTC[C/T]GCTTTCTTTCCGCATCCCTAAAAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 102680 MIM: 610977 MIM: 611526 | ||||||||||||||||||||
Literature Links: |
ADD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADD1 - adducin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFSD10 - major facilitator superfamily domain containing 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOP14 - NOP14 nucleolar protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291978.1 | 2679 | Missense Mutation | CAG,CGG | Q,R 831 | NP_001278907.1 | |
NM_001291979.1 | 2679 | Intron | NP_001278908.1 | |||
NM_003703.2 | 2679 | Missense Mutation | CAG,CGG | Q,R 831 | NP_003694.1 |
NOP14-AS1 - NOP14 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |