Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTCTGCAGGCTGTAGTGGTCGTC[C/T]GCGTCACTGCTGCTGCCAACACTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613430 MIM: 610887 | ||||||||||||||||||||
Literature Links: |
HAUS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HAUS3 - HAUS augmin like complex subunit 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4800 - microRNA 4800 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MXD4 - MAX dimerization protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006454.2 | 572 | Silent Mutation | GCA,GCG | A,A 180 | NP_006445.1 | |
XM_011513388.2 | 572 | Silent Mutation | GCA,GCG | A,A 234 | XP_011511690.1 | |
XM_017007655.1 | 572 | Intron | XP_016863144.1 | |||
XM_017007656.1 | 572 | Intron | XP_016863145.1 |
POLN - DNA polymerase nu | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |