Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCGCAGTCCTTCTCAGCATGGACC[A/G]CACTTGTGAGGAGAGGCCCGCTGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609385 MIM: 142810 MIM: 600549 | ||||||||||||||||||||
Literature Links: |
DND1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DND1 - DND microRNA-mediated repression inhibitor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HARS - histidyl-tRNA synthetase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IK - IK cytokine, down-regulator of HLA II | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR55 - WD repeat domain 55 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017706.4 | 122 | Missense Mutation | CAC,CGC | H,R 3 | NP_060176.2 | |
XM_005268469.2 | 122 | Missense Mutation | CAC,CGC | H,R 3 | XP_005268526.1 | |
XM_017009600.1 | 122 | Intron | XP_016865089.1 |