Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGACGAGTGCTGTTTGGACTTGAG[C/T]CGCAGGCTGGCTAGGCTCGAGTTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602149 | ||||||||||||||||||||
Literature Links: |
C5orf66 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C5orf66 - chromosome 5 open reading frame 66 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C5orf66-AS1 - C5orf66 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PITX1 - paired like homeodomain 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002653.4 | 1251 | Silent Mutation | CGA,CGG | R,R 286 | NP_002644.4 |