Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGGGAGTCGGACGCTGTGTCCTT[C/G]GTGACACTAGCCAGGAACTCGATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608186 MIM: 182307 | ||||||||||||||||||||
Literature Links: |
EXOC3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EXOC3 - exocyst complex component 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100288152 - uncharacterized LOC100288152 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PP7080 - uncharacterized LOC25845 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC9A3 - solute carrier family 9 member A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284351.2 | 2335 | Silent Mutation | ACC,ACG | T,T 732 | NP_001271280.1 | |
NM_004174.3 | 2335 | Silent Mutation | ACC,ACG | T,T 741 | NP_004165.2 |