Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCGCTGGTAACAGACTCACCACA[C/T]GCTTTGTTGATGAAGGTAGTGGCGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608170 MIM: 611435 MIM: 615813 | ||||||||||||||||||||
Literature Links: |
DDX41 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DDX41 - DEAD-box helicase 41 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321732.1 | 1998 | Silent Mutation | GCA,GCG | A,A 413 | NP_001308661.1 | |
NM_001321830.1 | 1998 | Silent Mutation | GCA,GCG | A,A 413 | NP_001308759.1 | |
NM_016222.3 | 1998 | Silent Mutation | GCA,GCG | A,A 539 | NP_057306.2 |
DOK3 - docking protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM193B - family with sequence similarity 193 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |