Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGTATTCATTTATGCTTGAAATTC[C/G]AGTCCTAGACCAAGCTTGTGGCCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604492 | ||||||||||||||||||||
Literature Links: |
C5orf15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C5orf15 - chromosome 5 open reading frame 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105379183 - uncharacterized LOC105379183 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VDAC1 - voltage dependent anion channel 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003374.2 | 1082 | Silent Mutation | CTC,CTG | L,L 279 | NP_003365.1 | |
XM_005272075.3 | 1082 | Intron | XP_005272132.1 | |||
XM_017009821.1 | 1082 | Intron | XP_016865310.1 | |||
XM_017009822.1 | 1082 | Intron | XP_016865311.1 | |||
XM_017009823.1 | 1082 | Intron | XP_016865312.1 |