Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGACAGCTCGAGTACTCAGTGCCG[G/T]AGGAGACGGAGCGGGGCGTAGCCGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606307 MIM: 606316 MIM: 606317 MIM: 606318 MIM: 606319 MIM: 606308 MIM: 606309 MIM: 606310 MIM: 606311 MIM: 606312 MIM: 606313 MIM: 606314 MIM: 606315 MIM: 606320 | ||||||||||||||||||||
Literature Links: |
PCDHA1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PCDHA1 - protocadherin alpha 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA10 - protocadherin alpha 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA11 - protocadherin alpha 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA12 - protocadherin alpha 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA13 - protocadherin alpha 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA2 - protocadherin alpha 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA3 - protocadherin alpha 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA4 - protocadherin alpha 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA5 - protocadherin alpha 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA6 - protocadherin alpha 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA7 - protocadherin alpha 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA8 - protocadherin alpha 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHA9 - protocadherin alpha 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHAC1 - protocadherin alpha subfamily C, 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |