Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGTGCACTGTGGGAAAGAGCTTGT[C/T]GCTGCGGTGTTGCTGTTGGAGACTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600549 MIM: 602137 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
IK PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
IK - IK cytokine, down-regulator of HLA II | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006083.3 | 52 | UTR 5 | NP_006074.2 |
MIR3655 - microRNA 3655 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFA2 - NADH:ubiquinone oxidoreductase subunit A2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001185012.1 | 52 | Intron | NP_001171941.1 | |||
NM_002488.4 | 52 | Intron | NP_002479.1 |
TMCO6 - transmembrane and coiled-coil domains 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300980.1 | 52 | Intron | NP_001287909.1 | |||
NM_001300982.1 | 52 | Intron | NP_001287911.1 | |||
NM_018502.4 | 52 | Intron | NP_060972.3 | |||
XM_005268477.1 | 52 | Intron | XP_005268534.1 | |||
XM_011537663.2 | 52 | Intron | XP_011535965.1 | |||
XM_011537665.2 | 52 | Intron | XP_011535967.1 | |||
XM_011537668.2 | 52 | Intron | XP_011535970.1 | |||
XM_017009617.1 | 52 | Intron | XP_016865106.1 | |||
XM_017009618.1 | 52 | Intron | XP_016865107.1 | |||
XM_017009619.1 | 52 | Intron | XP_016865108.1 | |||
XM_017009620.1 | 52 | Intron | XP_016865109.1 |