Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAAAGGAGATGCACCAGTCGGTGT[C/T]GACGGTGCCGCCGATGCGCGCTGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
C5orf45 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C5orf45 - chromosome 5 open reading frame 45 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100996419 - uncharacterized LOC100996419 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBC1D9B - TBC1 domain family member 9B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015043.3 | 3563 | Missense Mutation | AAC,GAC | N,D 1176 | NP_055858.2 | |
NM_198868.2 | 3563 | Missense Mutation | AAC,GAC | N,D 1193 | NP_942568.2 |