Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGAGGGGGCATAGGAAGAGGGAG[C/T]TGGCCCCCCTGAGTCATCAAGACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603186 MIM: 601962 MIM: 611439 | ||||||||||||||||||||
Literature Links: |
DAXX PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DAXX - death domain associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAPBP - TAP binding protein (tapasin) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB22 - zinc finger and BTB domain containing 22 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145338.1 | 1341 | Missense Mutation | ACT,GCT | T,A 403 | NP_001138810.1 | |
NM_005453.4 | 1341 | Missense Mutation | ACT,GCT | T,A 403 | NP_005444.4 |