Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGGAGACGACCTCCGAGAGCGAC[A/G]TGGACGAGACCATCGACGTGGGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604674 | ||||||||||||||||||||
Literature Links: |
HEY2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HEY2 - hes related family bHLH transcription factor with YRPW motif 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012259.2 | 46 | Missense Mutation | ATG,GTG | M,V 14 | NP_036391.1 | |
XM_017010627.1 | 46 | Intron | XP_016866116.1 | |||
XM_017010628.1 | 46 | UTR 5 | XP_016866117.1 | |||
XM_017010629.1 | 46 | Intron | XP_016866118.1 |
LOC105377986 - uncharacterized LOC105377986 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |