Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGTTGATCAGAAACACAAGCTGCT[A/C]CTTCCTTGAGGAGAACTCAGCTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 180473 MIM: 603443 | ||||||||||||||||||||
Literature Links: |
HCG25 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HCG25 - HLA complex group 25 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS18 - ribosomal protein S18 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPS52 - VPS52, GARP complex subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001289174.1 | 1900 | Nonsense Mutation | GAG,TAG | E,* 492 | NP_001276103.1 | |
NM_001289175.1 | 1900 | Nonsense Mutation | GAG,TAG | E,* 434 | NP_001276104.1 | |
NM_001289176.1 | 1900 | Nonsense Mutation | GAG,TAG | E,* 370 | NP_001276105.1 | |
NM_022553.5 | 1900 | Nonsense Mutation | GAG,TAG | E,* 559 | NP_072047.4 | |
XM_011514797.1 | 1900 | Nonsense Mutation | GAG,TAG | E,* 492 | XP_011513099.1 | |
XM_011514798.2 | 1900 | Nonsense Mutation | GAG,TAG | E,* 492 | XP_011513100.1 | |
XM_011514799.1 | 1900 | Nonsense Mutation | GAG,TAG | E,* 492 | XP_011513101.1 | |
XM_017011177.1 | 1900 | Nonsense Mutation | GAG,TAG | E,* 559 | XP_016866666.1 | |
XM_017011178.1 | 1900 | Nonsense Mutation | GAG,TAG | E,* 434 | XP_016866667.1 | |
XM_017011179.1 | 1900 | Intron | XP_016866668.1 |