Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCAGGCCTACCTTTTGGTGTCAAC[A/G]GTGGTAACATTGAAGGTGACTCCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606520 MIM: 602872 MIM: 604744 MIM: 603382 | ||||||||||||||||||||
Literature Links: |
C6orf25 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C6orf25 - chromosome 6 open reading frame 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CLIC1 - chloride intracellular channel 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001287593.1 | 708 | Silent Mutation | ACC,ACT | T,T 45 | NP_001274522.1 | |
NM_001287594.1 | 708 | Intron | NP_001274523.1 | |||
NM_001288.4 | 708 | Silent Mutation | ACC,ACT | T,T 45 | NP_001279.2 |
DDAH2 - dimethylarginine dimethylaminohydrolase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MSH5 - mutS homolog 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MSH5-SAPCD1 - MSH5-SAPCD1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |