Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACAAAGCTGCCCCCGGTGAAGTCT[A/G]CCATCCGTGGGCAAGCTCCTGTGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611248 MIM: 143170 MIM: 601646 MIM: 613475 | ||||||||||||||||||||
Literature Links: |
KLHDC3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KLHDC3 - kelch domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_057161.3 | 498 | Missense Mutation | ACC,GCC | T,A 65 | NP_476502.1 |
MEA1 - male-enhanced antigen 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318942.1 | 498 | Intron | NP_001305871.1 | |||
NM_001318943.1 | 498 | Intron | NP_001305872.1 | |||
NM_014623.3 | 498 | Intron | NP_055438.1 | |||
XM_005249121.3 | 498 | Intron | XP_005249178.1 | |||
XM_017010868.1 | 498 | Intron | XP_016866357.1 |
PPP2R5D - protein phosphatase 2 regulatory subunit B'delta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RRP36 - ribosomal RNA processing 36 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |