Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGTGCAGAACAGCGGGAAGATGC[A/G]CTCCCCCAGGGGGCCAGGCGCCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606670 MIM: 607524 MIM: 607525 MIM: 615714 | ||||||||||||||||||||
Literature Links: |
PPP1R11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PPP1R11 - protein phosphatase 1 regulatory inhibitor subunit 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021959.2 | 820 | Intron | NP_068778.1 | |||
XM_006715174.3 | 820 | Intron | XP_006715237.1 |
RNF39 - ring finger protein 39 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_025236.3 | 820 | Missense Mutation | CGC,TGC | R,C 399 | NP_079512.2 | |
NM_170769.2 | 820 | Missense Mutation | CGC,TGC | R,C 333 | NP_739575.2 | |
XM_017011325.1 | 820 | Missense Mutation | CGC,TGC | R,C 246 | XP_016866814.1 | |
XM_017011326.1 | 820 | Intron | XP_016866815.1 |
ZNRD1 - zinc ribbon domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNRD1ASP - zinc ribbon domain containing 1 antisense, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |