Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGGGCAGGGTGGAGGGCCAGGGC[C/T]GGGTTCAGCAAGGCCAGCCCCGCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610060 MIM: 612658 MIM: 609775 | ||||||||||||||||||||
Literature Links: |
LRRC73 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LRRC73 - leucine rich repeat containing 73 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012974.2 | 187 | Silent Mutation | CCA,CCG | P,P 107 | NP_001012992.1 | |
NM_001271882.1 | 187 | UTR 5 | NP_001258811.1 |
POLR1C - RNA polymerase I subunit C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TJAP1 - tight junction associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YIPF3 - Yip1 domain family member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |