Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAGCAGGACTTCCAGTACCTGAGA[C/T]AGAAGCTGTCACCTACCTACCCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607129 MIM: 603498 | ||||||||||||||||||||
Literature Links: |
MICAL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MICAL1 - microtubule associated monooxygenase, calponin and LIM domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPIL6 - peptidylprolyl isomerase like 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001111298.2 | 575 | Intron | NP_001104768.2 | |||
NM_001286360.1 | 575 | Intron | NP_001273289.1 | |||
NM_001286361.1 | 575 | Intron | NP_001273290.1 | |||
NM_173672.4 | 575 | Intron | NP_775943.1 | |||
XM_011535765.2 | 575 | Intron | XP_011534067.1 | |||
XM_011535766.2 | 575 | Intron | XP_011534068.1 | |||
XM_011535767.2 | 575 | Intron | XP_011534069.1 | |||
XM_011535769.2 | 575 | Intron | XP_011534071.1 | |||
XM_017010774.1 | 575 | Intron | XP_016866263.1 |
SMPD2 - sphingomyelin phosphodiesterase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003080.2 | 575 | Nonsense Mutation | CAG,TAG | Q,* 61 | NP_003071.2 | |
XM_005267109.1 | 575 | UTR 5 | XP_005267166.1 | |||
XM_011536079.1 | 575 | UTR 5 | XP_011534381.1 |