Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGTCCTGCAGTTCTGAGCTTGGG[C/T]TCCCTTTGCCTGGACACCAACCAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607744 MIM: 611389 MIM: 616168 | ||||||||||||||||||||
Literature Links: |
FRS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FRS3 - fibroblast growth factor receptor substrate 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRICKLE4 - prickle planar cell polarity protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013397.5 | 404 | Silent Mutation | GGC,GGT | G,G 52 | NP_037529.3 |
TOMM6 - translocase of outer mitochondrial membrane 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP49 - ubiquitin specific peptidase 49 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |