Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTGTGGTCATCGTCTCGGCGGCG[A/C]GGACCATCATAGGTGAGTGGCCGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 100678 MIM: 147460 MIM: 605442 | ||||||||||||||||||||
Literature Links: |
ACAT2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACAT2 - acetyl-CoA acetyltransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303253.1 | 400 | Intron | NP_001290182.1 | |||
NM_005891.2 | 400 | Silent Mutation | AGG,CGG | R,R 15 | NP_005882.2 |
LOC100129518 - uncharacterized LOC100129518 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SOD2 - superoxide dismutase 2, mitochondrial | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000636.3 | 400 | Intron | NP_000627.2 | |||
NM_001024465.2 | 400 | Intron | NP_001019636.1 | |||
NM_001024466.2 | 400 | Intron | NP_001019637.1 | |||
NM_001322814.1 | 400 | Intron | NP_001309743.1 | |||
NM_001322815.1 | 400 | Intron | NP_001309744.1 | |||
NM_001322816.1 | 400 | Intron | NP_001309745.1 | |||
NM_001322817.1 | 400 | UTR 5 | NP_001309746.1 | |||
NM_001322819.1 | 400 | Intron | NP_001309748.1 | |||
NM_001322820.1 | 400 | Intron | NP_001309749.1 |
WTAP - Wilms tumor 1 associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |