Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCTGTGTACTACAATGAAGCCAC[A/G]GGTAAGGGCAGGAGCCCGGGCAGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606998 MIM: 607593 MIM: 191130 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FLOT1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FLOT1 - flotillin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MDC1 - mediator of DNA damage checkpoint 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MDC1-AS1 - MDC1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUBB - tubulin beta class I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001293212.1 | 555 | Silent Mutation | ACA,ACG | T,T 75 | NP_001280141.1 | |
NM_001293213.1 | 555 | Silent Mutation | ACA,ACG | T,T 55 | NP_001280142.1 | |
NM_001293214.1 | 555 | Intron | NP_001280143.1 | |||
NM_001293215.1 | 555 | UTR 5 | NP_001280144.1 | |||
NM_001293216.1 | 555 | UTR 5 | NP_001280145.1 | |||
NM_178014.3 | 555 | Silent Mutation | ACA,ACG | T,T 55 | NP_821133.1 |