Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATGGAACAGAGCCTAGGGATCCAG[A/G]AGCATAGGAGGTGGTGGTGCTGGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 140572 MIM: 604548 MIM: 610788 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HSP90AB1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HSP90AB1 - heat shock protein 90 alpha family class B member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271969.1 | 1607 | Intron | NP_001258898.1 | |||
NM_001271970.1 | 1607 | Intron | NP_001258899.1 | |||
NM_001271971.1 | 1607 | Intron | NP_001258900.1 | |||
NM_001271972.1 | 1607 | Intron | NP_001258901.1 | |||
NM_007355.3 | 1607 | Intron | NP_031381.2 |
MIR4647 - microRNA 4647 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NFKBIE - NFKB inhibitor epsilon | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC35B2 - solute carrier family 35 member B2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286509.1 | 1607 | UTR 3 | NP_001273438.1 | |||
NM_001286510.1 | 1607 | UTR 3 | NP_001273439.1 | |||
NM_001286511.1 | 1607 | UTR 3 | NP_001273440.1 | |||
NM_001286512.1 | 1607 | UTR 3 | NP_001273441.1 | |||
NM_001286513.1 | 1607 | UTR 3 | NP_001273442.1 | |||
NM_001286517.1 | 1607 | UTR 3 | NP_001273446.1 | |||
NM_001286519.1 | 1607 | UTR 3 | NP_001273448.1 | |||
NM_001286520.1 | 1607 | UTR 3 | NP_001273449.1 | |||
NM_178148.3 | 1607 | UTR 3 | NP_835361.1 |