Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTGTGCGTTGAGACCCAGGCAAGG[A/G]CCAGCACCAGAAGGCAGGCAAGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616813 MIM: 606965 MIM: 109280 MIM: 614792 | ||||||||||||||||||||
Literature Links: |
AGAP3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AGAP3 - ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FASTK - Fas activated serine/threonine kinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC4A2 - solute carrier family 4 member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMUB1 - transmembrane and ubiquitin like domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136044.1 | 204 | Missense Mutation | GCC,GTC | A,V 25 | NP_001129516.1 | |
NM_031434.3 | 204 | Missense Mutation | GCC,GTC | A,V 25 | NP_113622.1 |