Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCAGCCCTGGGGCCACCCTGACGT[C/G]CACATCATGCAGCACCATGTCCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 100740 MIM: 614469 MIM: 602933 MIM: 611481 | ||||||||||||||||||||
Literature Links: |
ACHE PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACHE - acetylcholinesterase (Cartwright blood group) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SRRT - serrate, RNA effector molecule | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001128852.1 | 628 | Silent Mutation | GTC,GTG | V,V 120 | NP_001122324.1 | |
NM_001128853.1 | 628 | Silent Mutation | GTC,GTG | V,V 120 | NP_001122325.1 | |
NM_001128854.1 | 628 | Silent Mutation | GTC,GTG | V,V 120 | NP_001122326.1 | |
NM_015908.5 | 628 | Silent Mutation | GTC,GTG | V,V 120 | NP_056992.4 | |
XM_005250405.2 | 628 | Silent Mutation | GTC,GTG | V,V 127 | XP_005250462.1 | |
XM_005250406.2 | 628 | Silent Mutation | GTC,GTG | V,V 127 | XP_005250463.1 | |
XM_005250407.2 | 628 | Silent Mutation | GTC,GTG | V,V 127 | XP_005250464.1 | |
XM_005250408.2 | 628 | Silent Mutation | GTC,GTG | V,V 127 | XP_005250465.1 | |
XM_017012290.1 | 628 | Silent Mutation | GTC,GTG | V,V 41 | XP_016867779.1 | |
XM_017012291.1 | 628 | Silent Mutation | GTC,GTG | V,V 41 | XP_016867780.1 |
TRIP6 - thyroid hormone receptor interactor 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UFSP1 - UFM1 specific peptidase 1 (inactive) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |