Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGTCTCTGCTCTAACTGGCCACC[A/G]GGGCCATTGTCTTCTGACACAGCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605719 MIM: 600404 | ||||||||||||||||||||
Literature Links: |
LAT2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LAT2 - linker for activation of T-cells family member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RFC2 - replication factor C subunit 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278791.1 | 873 | Intron | NP_001265720.1 | |||
NM_001278792.1 | 873 | Intron | NP_001265721.1 | |||
NM_001278793.1 | 873 | Intron | NP_001265722.1 | |||
NM_002914.4 | 873 | Intron | NP_002905.2 | |||
NM_181471.2 | 873 | Intron | NP_852136.1 | |||
XM_006716080.2 | 873 | Missense Mutation | CCG,CTG | P,L 214 | XP_006716143.1 | |
XM_017012492.1 | 873 | Missense Mutation | CCG,CTG | P,L 250 | XP_016867981.1 | |
XM_017012493.1 | 873 | Missense Mutation | CCG,CTG | P,L 214 | XP_016867982.1 |